If you have been reading about Mass spectrometry and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2026-07-02. Where a claim depends on a specific study, the study is described rather than over-claimed.
BPC-157 is a synthetic pentadecapeptide with the sequence GEPPPGKPADDAGLV, corresponding to a partial fragment of a larger protein detected in human gastric juice. The name derives from the parent protein designation BPC, an abbreviation of body protection compound, with 157 acting as a fraction or batch identifier used by the original investigators. Its molecular weight is approximately 1419 daltons, and the chain contains no unusual residues or disulfide bridges. In the literature it is described as a short, water-soluble fragment rather than a complete natural protein.
Most early work on this peptide originated in the 1990s from a research group in Zagreb, Croatia, relying on animal models and cell cultures. Reported observations included effects on gastrointestinal lesion healing, tendon fibroblast migration, and blood vessel formation under controlled laboratory conditions. These findings come predominantly from rodent studies and in vitro assays rather than from human trials. Controlled human data remain limited, and the degree to which animal results translate to human physiology is an open question rather than a settled fact.
BPC-157 is a synthetic peptide of fifteen amino acids, written as GEPPPGKPADDAGLV, whose sequence matches part of a larger protein identified in human gastric juice. That parent protein was described in stomach-secretion research, and the fifteen-residue fragment was named body protection compound, which gives the peptide its common label. Material used in experiments is produced by solid-phase peptide synthesis rather than extracted from tissue. The reported molecular weight is about 1419 daltons, and the chain contains several proline residues, a feature that appears in discussions of its resistance to enzymatic breakdown.
Most published findings come from rodent models, where the peptide has been examined in wound-healing, gastrointestinal-lesion, tendon, and vascular-injury preparations. A smaller number of early human studies have been reported, chiefly in inflammatory bowel conditions, but the public record is short and has not led to marketing approval in the United States or the European Union. Reviewers therefore classify the compound as investigational, and whether animal results carry over to people remains an open question rather than a settled one.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C62H98N16O22 | computed for the free peptide |
| Molecular weight | about 1419 Da | monoisotopic mass near 1418.7 |
| Amino acid count | 15 | single chain, no disulfide bonds |
| Solubility | freely soluble in water | also dissolves in saline and phosphate buffer |
| Common synonyms | pentadecapeptide BPC, BPC 157 | fragment notation varies by source |
Lyophilized material is generally reported as stable for extended periods when kept cold, dry, and protected from light. In solution, the main degradation routes for a peptide of this type are hydrolysis of peptide bonds and aggregation. The sequence contains no cysteine, so disulfide-driven oxidation is not a primary concern, though methionine and tryptophan are also absent. Stability depends on pH, buffer composition, and concentration, with acidic conditions often reported as more favorable than neutral or alkaline ones. Repeated freeze-thaw cycles can promote aggregation, and how fast degradation proceeds at room temperature in specific formulations remains an open question.
Handling practice centers on limiting moisture, heat, and mechanical stress. Powder is typically allowed to reach room temperature before opening so that condensation does not form on the contents, and solutions are prepared with sterile or low-particulate water. Peptides can adsorb to certain plastics and membrane filters, so container and filter material is sometimes specified to reduce losses at low concentrations. Working aliquots are usually frozen separately rather than sampled repeatedly from one stock. Recording lot number, preparation date, and storage conditions supports later comparison between experiments.
Identity and purity are usually assessed with reversed-phase high-performance liquid chromatography, often paired with mass spectrometry using electrospray or MALDI ionisation. Amino acid analysis and peptide mapping by enzymatic digestion provide additional sequence-level confirmation. Purity is commonly reported as an area percentage from a chromatographic trace, and water content can be measured by Karl Fischer titration. Reported masses may differ by tens of daltons between sources because preparations can contain acetate or trifluoroacetate counterions, and such differences are not by themselves evidence of a different peptide.
BPC-157 is normally distributed as a lyophilised powder that ranges from white to off-white in appearance. The peptide dissolves readily in water, normal saline, and common aqueous buffers, and it is poorly soluble in nonpolar solvents such as hexane or vegetable oils. Lyophilised vials take up moisture if left open, which changes the mass of powder in the container and complicates any later weighing. Because the material is handled in small quantities, static and adhesion to glass or plastic can also cause noticeable losses during transfer.
The main chemical liabilities of this sequence are peptide-bond hydrolysis and possible aspartate-related reactions, since the peptide contains aspartic acid residues but no cysteine, methionine, or tryptophan. Absence of those three residues removes the most common oxidation and disulfide pathways from consideration. Studies of related peptides indicate that aspartate isomerisation and aspartimide formation occur most readily at Asp-Gly and Asp-Ala positions, and open questions remain about how quickly those reactions proceed under ordinary laboratory conditions. Storage guidance typically emphasises cool, dry, dark conditions to slow hydrolysis.
KGOP01 (H-Dmt-d-Arg-Aba-β-Ala-NH2) is a synthetic peptide derivative which acts as a potent agonist of opioid receptors and has analgesic effects. It was originally derived from modification of dermorphin, a naturally occurring opioid peptide secreted by some species of South American frogs. While numerous opioid peptides are known and widely used in scientific research, such as DAMGO and DADLE, these are rapidly metabolised in the body and fail to cross the blood-brain barrier, and so do not produce centrally mediated analgesic effects. KGOP01 on the other hand contains several unnatural amino acids and is both metabolically stable and able to enter the brain, resulting in potent analgesic effects in animal studies. Because it is a peptide, it can be readily hybridised with other peptide ligands and so has been widely used to produce hybrid compounds combining opioid activity with activity at receptors for neuropeptides such as nociceptin, neurokinin, neurotensin and neuropeptide FF, which may lead to the development of improved opioid analgesics with reduced side effects.
The General bails out but is immediately attacked by the escaped Worm Xenome, which comes out of a crevice and consumes him once again. The Mainframe states its intention to make the Xenome facility its home as it calls for backup, and Gunman reinforcements arrive shortly after to contain the Xenome infestation and capture any remaining rogue Gunmen.
Although the receptors for systemins and HypSys remain poorly understood, we have a better understanding of the signal transduction that occurs once the peptide had bound to its receptor. Jasmonic acid is an essential, albeit late component, in the systemin and wound-signalling pathways. In tomato, the signal is transduced from the receptor by mitogen-activated protein kinases (MAPKs). Cosilencing of two MAPKs, MPK1 and MPK2, in tomato compromised their defence response against insect larvae compared to wild type plants. Cosilencing these genes also decreased production of jasmonic acid and of jasmonic acid-dependent defence genes. Applying methyl jasmonate to cosilenced plants rescued them, indicating that jasmonates are the signal responsible for causing changes in gene expression. The alkalisation of the apoplast is a downstream effect of signalling processing by MAPKs. Applying fusicoccin, which activates the H+ ATPase inhibited by systemin, along with systemin still activates MAPKs, even though the pH of the apoplast does not change. Within minutes of systemin perception, the cytosolic Ca2+ concentration increases, and linolenic acid is released from cell membranes after a phospholipase has been activated. Linolenic acid is then converted to jasmonic acid via the octadecanoid pathway and jasmonic acid activates defensive genes. Production of methyl jasmonate is induced by systemins and also upregulates systemin precursor genes creating a feedback loop, amplifying the defensive signal.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Evolution === The ancestors of American black bears and Asian black bears diverged from sun bears 4.58 mya. The American black bear then split from the Asian black bear 4.08 mya. A small, primitive bear genus called protarctos (U. abstrusus) is the oldest known North American fossil member of the genus Ursus, dated to 4.95 mya. This suggests that U. abstrusus may be the direct ancestor of the American black bear, which evolved in North America. The earliest American black bear fossils, from the Early Pleistocene of Port Kennedy, Pennsylvania, greatly resemble the Asian species, though later specimens grew to sizes comparable to grizzly bears. Once described as a precursor species (Ursus vitabilis), these specimens have been synonymized with U. americanus. The American black bear lived during the same period as the giant and lesser short-faced bears (Arctodus simus and A. pristinus, respectively) and the Florida spectacled bear (Tremarctos floridanus). These tremarctine bears evolved from bears that had emigrated from Asia to the Americas 7–8 mya. The giant and lesser short-faced bears are thought to have been heavily carnivorous and the Florida spectacled bear more herbivorous, while the American black bears remained arboreal omnivores, like their Asian ancestors. From the Holocene to the present, American black bears seem to have shrunk in size, but this has been disputed because of problems with dating these fossil specimens.
After electrophoresis is complete, the molecules in the gel can be stained to make them visible. DNA may be visualized using ethidium bromide which, when intercalated into DNA, fluoresce under ultraviolet light, while protein may be visualised using silver stain or Coomassie brilliant blue dye. Other methods may also be used to visualize the separation of the mixture's components on the gel. If the molecules to be separated contain radioactivity, for example in a DNA sequencing gel, an autoradiogram can be recorded of the gel. Photographs can be taken of gels, often using a gel doc system. Gels are then commonly labelled for presentation using a number of tools, such as Adobe Illustrator, GIMP, ImageJ, Microsoft PowerPoint, and sciugo.
== Partition coefficient and log P == The partition coefficient, abbreviated P, is defined as a particular ratio of the concentrations of a solute between the two solvents (a biphase of liquid phases), specifically for un-ionized solutes, and the logarithm of the ratio is thus log P. When one of the solvents is water and the other is a non-polar solvent, then the log P value is a measure of lipophilicity or hydrophobicity. The defined precedent is for the lipophilic and hydrophilic phase types to always be in the numerator and denominator respectively; for example, in a biphasic system of n-octanol (hereafter simply "octanol") and water:
Sources: en.wikipedia.org
Cracking breaks larger molecules into smaller ones. This reaction requires heat and catalysts. The thermal cracking process follows a homolytic mechanism with formation of free radicals. The catalytic cracking process involves the presence of acid catalysts (usually solid acids such as silica-alumina and zeolites), which promote a heterolytic (asymmetric) breakage of bonds yielding pairs of ions of opposite charges, usually a carbocation. Carbon-localized free radicals and cations are both highly unstable and undergo processes of chain rearrangement, C–C scission in position beta (i.e., cracking) and intra- and intermolecular hydrogen transfer or hydride transfer. In both types of processes, the corresponding reactive intermediates (radicals, ions) are permanently regenerated, and thus they proceed by a self-propagating chain mechanism. The chain of reactions is eventually terminated by radical or ion recombination.
S: The number of susceptible individuals. When a susceptible and an infectious individual come into "infectious contact", the susceptible individual contracts the disease and transitions to the infectious compartment. I: The number of infectious individuals. These are individuals who have been infected and are capable of infecting susceptible individuals. R for the number of removed (and immune) or deceased individuals. These are individuals who have been infected and have either recovered from the disease and entered the removed compartment, or died. It is assumed that the number of deaths is negligible with respect to the total population. This compartment may also be called "recovered" or "resistant". This model is reasonably predictive for infectious diseases that are transmitted from human to human, and where recovery confers lasting resistance, such as measles, mumps, and rubella.
=== Grhl2 === Grhl2 is involved in lower jaw formation of mammals, among other craniofacial developmental processes. It is also evolutionarily closest to Grhl1, compared to Grhl3, while still exhibiting the highly conserved functions that all Grhl genes share. It also appears that Grhl2 is involved in the fusion of the facial bones and that disruption to the regulation of Grhl2 can lead to cranioschisis/split face during embryonic development, often causing death. Continuing with the trend of incomplete fusion, the formation of the neural tube and abdominal wall is also regulated by Grhl2, evident by observation of incomplete closure of these structures, leading to spina bifida and thoracoabdominoschisis, following loss of Grhl2 function in mutant mice models for Grhl2. Additionally, over-expression of Grhl2 can also lead to mice developing spina bifida, showing the delicate balance in regulation required for Grhl2. Grhl2 is also related to breast cancer progression due to its ability to regulate epithelial cells and other processes such as epithelial-mesenchymal transition (EMT), although it is not known if EMT is promoted or inhibited by Grhl2. However, tumour progression is more associated with the epithelial tissue phenotype. Interestingly, within zebrafish there are two separate orthologues, grhl2a and grhl2b. Comparing the homology of these two orthologues to the human and mice equivalent, Grhl2, showed that grhl2b had 36 out of 47 amino acids identical (77% identical), meaning it was slightly more conserved than grhl2a, which had 34 out of 47 (72% identical).
== Laboratory methods == Hemoglobin A2 has a crucial role in screening and diagnosis of the beta-thalassemia trait. Various laboratory methods exist, each providing different outcomes of accuracy. The different quantification methods of HbA2 relies on how effective it can be separated from other hemoglobin variants. Various laboratory methods are employed, such as cation exchange high-performance liquid chromatography (HPLC), microcolumn chromatography, and cellulose acetate electrophoresis with elution. At first, cellulose acetate electrophoresis was utilized to measure HbA2, but this process proved to be too time-consuming and labor-intensive, making it impractical for large examinations or samples. Similar efficiency issues were encountered with other methods like IEF and scanning densitometry. These two methods separate proteins based on their isoelectric point. Chromatography, another commonly used method, demonstrated reliability in diagnosing individuals with the beta carrier gene. However, this method was also time-consuming and inefficient when dealing with large sample numbers. Out of the various methods, the one that accurately measures HbA2 is HPLC. It is a reliable technique because it's able to accurately determine HbA2, HbF, and Hb variants. The various different Hb variants include: HbS, HbE, Hb Lepore, HbC, HbD and HbO-Arab. There are several different factors that can contribute to the quantification of HbA2 to be inaccurately measured.
=== Graph based === Similarly to string-based methods, the molecular graph can directly be used as input for QSAR models, but usually yield inferior performance compared to descriptor-based QSAR models.
Sources: en.wikipedia.org
The sequence corresponds to a fragment of a protein found in human gastric juice, so related sequences are natural. The isolated fifteen-amino-acid peptide supplied for research is produced synthetically. Whether the free fragment circulates naturally in humans has not been settled.
In most jurisdictions it is not an approved medicine and is handled as a research material. Import and sale rules differ by country, and some regulators have placed it in categories that restrict human use. Status can change, so current local rules apply.
Rodent models dominate, particularly rats with induced gastric lesions, tendon injury, or vascular disruption. These designs allow controlled comparison but differ anatomically and metabolically from humans. Results from such models are commonly cited as preliminary.
It is not approved for human use in the United States or the European Union. Clinical material has been studied in a small number of early trials, mainly for inflammatory bowel conditions, and the compound remains investigational. Regulators treat marketed products as unapproved rather than as authorized drugs.