The short version of rodent models fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-01-27. Anything still debated is marked as such rather than presented as settled.
BPC 157 is a synthetic peptide built from fifteen amino acids. The letters stand for body protection compound, and the number is a laboratory code rather than a description of any biological feature. Its single-letter sequence is GEPPPGKPADDAGLV, which corresponds to a calculated mass near 1419.5 daltons. The material is produced by solid-phase peptide synthesis and is distributed as a lyophilized powder, not as a purified extract from a natural source.
Early work on this family of molecules examined fractions of human gastric juice, where a larger protein was reported to protect gastrointestinal tissue in animal models. BPC 157 was designed as a shorter, more stable fragment of that protein and then studied on its own. The peptide itself is not a normal dietary component and is not present in the human body in meaningful quantities. Descriptions of its origin therefore refer to the research lineage of a laboratory molecule rather than to an endogenous or nutritional substance.
The sequence contains an unusually high proportion of proline and glycine, which limits regular secondary structure and contributes to solubility in aqueous media. The compound dissolves readily in water and in normal saline. Because it is a peptide, digestive enzymes are expected to break it down if it is swallowed, a consideration that influences the routes of administration used in animal experiments. Detailed conformational data remain limited, and published structural models are largely computational.
BPC-157 is a synthetic peptide composed of fifteen amino acids. Its sequence corresponds to part of a protein found in human gastric juice, which is the origin of the "body protection compound" label. In laboratory work the material is treated as a defined research chemical rather than a finished product. Published research has centered on animal models, and the peptide is not an approved medicine in most countries.
The peptide was first described in the early 1990s by a group studying gastric secretions and tissue repair. Its fifteen-residue chain is usually written as GEPPPGKPADDAGLV in single-letter code. The free peptide has the formula C62H98N16O22 and a theoretical mass near 1419.5 daltons. These identifiers are established chemical facts that can be checked against standard peptide databases. There is no ambiguity about the primary structure.
Most published findings come from rodent experiments using induced injury or surgical models. Human reports remain scarce and are largely observational, which limits how much can be stated with confidence. Questions about absorption, distribution, metabolism, and clearance in people are still open. Dose translation between species is likewise unresolved. Researchers tend to read the animal literature as a starting point rather than a settled account.
| Property | Value | Notes |
|---|---|---|
| Molecular weight | About 1419.5 Da | Calculated from the fifteen-residue sequence |
| Residue count | 15 amino acids | Single-letter sequence GEPPPGKPADDAGLV |
| Compound class | Synthetic peptide | Produced by solid-phase synthesis |
| Synonyms | BPC 157; pentadecapeptide BPC 157 | Naming varies across suppliers and papers |
| Appearance | White to off-white powder | Typical form of the lyophilized material |
Lyophilized peptide powder is generally stored at minus twenty degrees Celsius or lower and kept away from light and moisture. Under these conditions degradation is slow, and sealed vials remain stable for extended periods. Once dissolved, the material is less stable, particularly in aqueous buffers near neutral pH, where hydrolysis and oxidation proceed faster. Solutions are usually kept cold and used within days to weeks. Repeated freeze-thaw cycles are avoided because they encourage aggregation.
Identity and purity are established using reversed-phase high-performance liquid chromatography, which separates the peptide from related impurities and yields a percentage purity. Mass spectrometry, typically with electrospray ionization, confirms the molecular mass against the expected value. Amino acid analysis or peptide mapping provides additional sequence confirmation. These methods are complementary, since chromatography measures how much material is present while mass spectrometry verifies what that material is. A certificate of analysis normally reports both.
Lyophilized material is generally reported as stable for extended periods when kept cold, dry, and protected from light. In solution, the main degradation routes for a peptide of this type are hydrolysis of peptide bonds and aggregation. The sequence contains no cysteine, so disulfide-driven oxidation is not a primary concern, though methionine and tryptophan are also absent. Stability depends on pH, buffer composition, and concentration, with acidic conditions often reported as more favorable than neutral or alkaline ones. Repeated freeze-thaw cycles can promote aggregation, and how fast degradation proceeds at room temperature in specific formulations remains an open question.
Handling practice centers on limiting moisture, heat, and mechanical stress. Powder is typically allowed to reach room temperature before opening so that condensation does not form on the contents, and solutions are prepared with sterile or low-particulate water. Peptides can adsorb to certain plastics and membrane filters, so container and filter material is sometimes specified to reduce losses at low concentrations. Working aliquots are usually frozen separately rather than sampled repeatedly from one stock. Recording lot number, preparation date, and storage conditions supports later comparison between experiments.
=== Industries === Leeds has since attracted investment from financial institutions, to become a recognised financial centre, with many banks, building societies and insurance companies having offices in the city. Wakefield has also attracted many service-based industries, in particular call centres. Two of the big four supermarkets are from West Yorkshire. Morrisons is based in Bradford, while Asda is based in Leeds. West Yorkshire grew up around several industries. Wakefield, Castleford, Pontefract and South and East Leeds were traditional coal mining areas.
SOCl2 + H2O → 2 HCl + SO2 By a similar process it also reacts with alcohols to form alkyl chlorides. If the alcohol is chiral the reaction generally proceeds via an SNi mechanism with retention of stereochemistry; however, depending on the exact conditions employed, stereo-inversion can also be achieved. Historically the use of SOCl2 with pyridine was called the Darzens halogenation, but this name is rarely used by modern chemists.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Sources: en.wikipedia.org
==== Covalently linked gels ==== Three-dimensional covalently linked polymer networks are insoluble in all solvents, they merely swell in good solvents. Thermoresponsive polymer gels show a discontinuous change of the degree of swelling with temperature. At the volume phase transition temperature (VPTT) the degree of swelling changes drastically. Researchers try to exploit this behavior for temperature-induced drug delivery. In the swollen state, previously incorporated drugs are released easily by diffusion. More sophisticated "catch and release" techniques have been elaborated in combination with lithography and molecular imprinting.
A multistep biochemical pathway like the Krebs cycle did not just self-organize on the surface of a mineral; it must have been preceded by simpler pathways. The Wood–Ljungdahl pathway is compatible with self-organization on a metal sulfide surface. Its key enzyme unit, carbon monoxide dehydrogenase/acetyl-CoA synthase, contains mixed nickel-iron-sulfur clusters in its reaction centers and catalyzes the formation of acetyl-CoA. However, prebiotic thiolated and thioester compounds are thermodynamically and kinetically unlikely to accumulate in the presumed prebiotic conditions of hydrothermal vents. One possibility is that cysteine and homocysteine may have reacted with nitriles from the Strecker reaction, forming catalytic thiol-rich polypeptides. It has been suggested that the iron-sulfur world hypothesis and RNA world hypothesis are not mutually exclusive as modern cellular processes do involve both metabolites and genetic molecules.
The densities of the two phases must also be sufficiently different so that the phases will move past each other in the column. Many DCCC solvent systems contain both chloroform and water. The solvent system used in the seminal publication was made from chloroform, acetic acid, and aqueous 0.1 M hydrochloric acid. Many subsequent solvents systems were made with chloroform, methanol, and water which is sometimes represented as a ChMWat solvent system. Solvent systems formulated with ''n''-butanol, water and a modifier such as acetic acid, pyridine or n-propanol have also enjoyed some success in DCCC. In some cases, non-aqueous biphasic solvent systems such as acetonitrile and methanol have been utilized. The main difference between DCCC and other types of countercurrent chromatography techniques is that there is no vigorous mixing of phases to enhance the mass transfer of compounds that allows them to distribute between the two phases. In 1951 Kies and Davis described an apparatus similar to the DCCC. They created a series of open tubes that were arranged in a cascade to either drip a more dense phase through a less dense stationary phase or, conversely, a less dense phase could be introduced into the bottom of the tube to dribble through the more dense phase. In 1954, a fractionation column was introduced by Kepes the resembled a CCC column divided into chambers with perforated plastic disks. Similar DCCC-type instruments have been created by A. E. Kostanyan and collaborators which employ vertical columns that are divided into partitions with porous disks.
Sources: en.wikipedia.org
There have been several enantioselective versions of this reaction developed, and even employed in synthesis of complex molecules. Hoyveda's synthesis of (R)-(-)-sporochnol included an asymmetric copper-catalyzed allylic substitution with an organozinc nucleophile and peptide ligand. A TaniaPHOS ligand, a ferrocenylphosphine, is used with a methyl Grignard nucleophile to form an allylic stereocenter towards the total synthesis of (S)-(-)-Zearalenone
For nanoparticles dispersed in a medium of different composition, the interfacial layer — formed by ions and molecules from the medium that are within a few atomic diameters of the surface of each particle — can mask or change its chemical and physical properties. Indeed, that layer can be considered an integral part of each nanoparticle.
== Mechanism == Riboflavin is converted into catalytically active cofactors FAD and FMN by the actions of riboflavin kinase EC 2.7.1.26, which converts it into FMN, and FAD synthetase EC 2.7.7.2, which adenylates FMN to FAD. The RFK module phosphorylates the riboflavin substrate and converts it into FMN, which is then released from the module. This reaction is dependent on an ATP molecule stabilized by an Mg2+ ion, which causes only a single phosphate group to leave the ATP and bond to riboflavin. The released FMN then joins to the N-terminal FMNAT module and is adenylated, with the adenylyl group of ATP attaching to the phosphate group on FMN and the diphosphate group leaving. ATP + riboflavin ⇌ ADP + FMN ATP + FMN ⇌ diphosphate + FAD
=== Hypothalamic === While all neurons use glucose for fuel, certain glucose-sensing neurons alter their firing rates in response to rising or falling levels of glucose. These glucose-sensing neurons are concentrated primarily in the ventromedial nucleus and arcuate nucleus of the hypothalamus, which regulate many aspects of glucose homeostasis (especially the response to hypoglycemia), fuel utilization, satiety and appetite, and weight maintenance. These neurons are most sensitive to glucose changes in the 0.5–3.5 mM glucose range. Glucokinase has been found in the brain in largely the same areas that contain glucose-sensing neurons, including both of the hypothalamic nuclei. Inhibition of glucokinase abolishes the ventromedial nucleus response to a meal. However, brain glucose levels are lower than plasma levels, typically 0.5–3.5 mM. Although this range is matches the sensitivity of the glucose-sensing neurons, it is below the optimal inflection sensitivity for glucokinase. The presumption, based on indirect evidence and speculation, is that neuronal glucokinase is somehow exposed to plasma glucose levels even in the neurons.
Sources: en.wikipedia.org
It is a synthetic peptide. Its design was inspired by a fragment of a protein found in human gastric juice, but the fifteen-amino-acid molecule itself is made in a laboratory and is not a normal component of food or of human tissue in appreciable amounts.
The number is an internal laboratory designation from the research group that first described the fragment. It does not encode a molecular weight, a receptor target, or a measured biological effect, and it carries no meaning outside the naming history of the compound.
It contains fifteen amino acid residues and has a calculated mass of roughly 1419.5 daltons. That places it in the short-peptide range, well below the size of small proteins, which affects how it is synthesized, purified, and analyzed.
The peptide is synthetic, but its sequence matches a segment of a protein present in human gastric juice. It does not occur as a free fifteen-residue peptide in the body.