Everything below concerns evidence base. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2026-03-03. Numbers and descriptions here follow the published literature rather than marketing material.
Most published findings come from rodent models, where the peptide has been examined in wound-healing, gastrointestinal-lesion, tendon, and vascular-injury preparations. A smaller number of early human studies have been reported, chiefly in inflammatory bowel conditions, but the public record is short and has not led to marketing approval in the United States or the European Union. Reviewers therefore classify the compound as investigational, and whether animal results carry over to people remains an open question rather than a settled one.
Outside laboratory supply channels, the peptide is sold as a research chemical, a category that carries no requirement to demonstrate purity, identity, or freedom from contamination. Because it is not an approved medicine, products labeled BPC-157 sit in a regulatory gap in many countries, and actual content may differ from the label. Sports organizations list it among prohibited substances, so its presence in an athlete's sample can produce a doping finding regardless of how the material was obtained.
BPC-157 is a synthetic peptide of fifteen amino acids, written as GEPPPGKPADDAGLV, whose sequence matches part of a larger protein identified in human gastric juice. That parent protein was described in stomach-secretion research, and the fifteen-residue fragment was named body protection compound, which gives the peptide its common label. Material used in experiments is produced by solid-phase peptide synthesis rather than extracted from tissue. The reported molecular weight is about 1419 daltons, and the chain contains several proline residues, a feature that appears in discussions of its resistance to enzymatic breakdown.
Identity and purity are usually assessed by reversed-phase high-performance liquid chromatography, which separates the target peptide from truncated sequences and other synthesis by-products. Mass spectrometry, typically electrospray ionization coupled to liquid chromatography, confirms the expected mass and helps detect modifications. Amino acid analysis can verify composition when residue-level confirmation is needed. Because common impurities differ from the target by only one or two residues, chromatographic resolution often matters more than a single headline purity percentage. Impurity profiles are most informative when compared against a validated reference standard.
Lyophilized material is generally reported as stable for extended periods when kept cold, dry, and protected from light. In solution, the main degradation routes for a peptide of this type are hydrolysis of peptide bonds and aggregation. The sequence contains no cysteine, so disulfide-driven oxidation is not a primary concern, though methionine and tryptophan are also absent. Stability depends on pH, buffer composition, and concentration, with acidic conditions often reported as more favorable than neutral or alkaline ones. Repeated freeze-thaw cycles can promote aggregation, and how fast degradation proceeds at room temperature in specific formulations remains an open question.
| Property | Value | Notes |
|---|---|---|
| Origin | Fragment of a protein found in human gastric juice | Sequence corresponds to a fifteen-residue portion of the parent protein |
| Sequence | GEPPPGKPADDAGLV | Single linear chain, fifteen amino acids |
| Reported molecular weight | About 1419 daltons | Value quoted consistently in supplier and review literature |
| Regulatory status | Not an approved human medicine in the US or EU | Handled and sold as a research chemical |
| Sports status | Listed as prohibited | Falls under non-approved-substance categories in anti-doping codes |
The main chemical liabilities of this sequence are peptide-bond hydrolysis and possible aspartate-related reactions, since the peptide contains aspartic acid residues but no cysteine, methionine, or tryptophan. Absence of those three residues removes the most common oxidation and disulfide pathways from consideration. Studies of related peptides indicate that aspartate isomerisation and aspartimide formation occur most readily at Asp-Gly and Asp-Ala positions, and open questions remain about how quickly those reactions proceed under ordinary laboratory conditions. Storage guidance typically emphasises cool, dry, dark conditions to slow hydrolysis.
Identity and purity are usually assessed with reversed-phase high-performance liquid chromatography, often paired with mass spectrometry using electrospray or MALDI ionisation. Amino acid analysis and peptide mapping by enzymatic digestion provide additional sequence-level confirmation. Purity is commonly reported as an area percentage from a chromatographic trace, and water content can be measured by Karl Fischer titration. Reported masses may differ by tens of daltons between sources because preparations can contain acetate or trifluoroacetate counterions, and such differences are not by themselves evidence of a different peptide.
BPC-157 is normally distributed as a lyophilised powder that ranges from white to off-white in appearance. The peptide dissolves readily in water, normal saline, and common aqueous buffers, and it is poorly soluble in nonpolar solvents such as hexane or vegetable oils. Lyophilised vials take up moisture if left open, which changes the mass of powder in the container and complicates any later weighing. Because the material is handled in small quantities, static and adhesion to glass or plastic can also cause noticeable losses during transfer.
BPC-157 is a synthetic peptide of fifteen amino acids, written in single-letter code as GEPPPGKPADDAGLV. The sequence corresponds to a partial fragment of a protein isolated from human gastric juice, described in early reports as body protection compound. The number 157 refers to a fragment designation in that work rather than to molecular mass. Initial descriptions appeared in the early 1990s, when the fragment was reported to protect gastrointestinal tissue in animal models. Commercial material is produced by solid-phase peptide synthesis rather than extracted from biological sources.
Laboratory research on this peptide has examined a wide and heterogeneous set of endpoints, including gastric ulcer models, tendon and ligament injury, wound closure, and intestinal inflammation. Most published findings come from rodent studies, and reported effect sizes are often large relative to controls. Because the compound has been tested across many unrelated injury models, the literature is frequently described as unusually broad for a single peptide. A substantial share of this work originates from a small number of research groups, which matters when assessing how widely results have been reproduced.
Evidence in humans is limited. Small clinical studies have examined the peptide in contexts such as ulcerative colitis and wound healing, but participant numbers are small and independent replication is scarce. It is not approved as a medicine by major regulatory agencies and is distributed mainly as a research material or compounded preparation. Long-term human safety data are not established, and questions about absorption through non-injected routes remain open rather than resolved. Claims about its effects are best read against these gaps.
Most published work on BPC-157 consists of preclinical studies, including rodent models of tissue injury, gastrointestinal lesions, and vascular or tendon damage, together with in vitro cell assays. Reviews frequently note that the mechanisms proposed in these papers remain incompletely characterised and that findings have not been confirmed in large randomised human trials. The compound is widely sold as a research chemical rather than a licensed medicine, and labels commonly carry a statement that it is not for human use. Whether any of the reported animal effects translate to humans is an open question rather than an established result.
Terminology in the literature is not fully standardised. Papers and product listings use BPC-157, BPC 157, and the longer phrase stable gastric pentadecapeptide BPC 157 interchangeably, and synonyms such as bepecin or PL 14736 appear in older or company-linked publications. Purity claims and reported masses can also differ between sources because peptide preparations may include counterions, residual solvents, or bound water. This variability complicates direct comparison of results across studies and makes the exact identity and grade of a given sample worth verifying. Discussions of the compound should therefore specify the source, salt form, and stated purity where those are known.
BPC-157 is a synthetic peptide composed of fifteen amino acid residues, with the sequence Gly-Glu-Pro-Pro-Pro-Gly-Lys-Pro-Ala-Asp-Asp-Ala-Gly-Leu-Val. Its name derives from body protection compound, a term used for a protein fraction identified in human gastric juice. Researchers in Zagreb first reported the pentadecapeptide in the early 1990s and described it as a stable fragment of that larger protein. The compound is also catalogued as PL 14736 and, in some commercial contexts, as bepecin. Its molecular formula is C62H98N16O22 and its monoisotopic mass is approximately 1419 daltons.
Most published reports describe experiments in rodents rather than in people. These studies examine outcomes in tendons, ligaments, bone, stomach lining, and intestinal tissue. In rat and mouse models, a frequently reported effect is faster healing or reduced damage. Sample sizes are usually small, and a substantial share of the work originates from a small number of research groups. Independent replication is limited, so how far the findings extend to humans remains an open question.
Proposed mechanisms in the literature involve the nitric oxide system, vascular endothelial growth factor signaling, and epidermal growth factor receptor pathways. Some studies report changes in blood vessel formation or in inflammatory mediators, while others describe interactions with nervous tissue. Much of this evidence rests on molecular markers in cultured cells or animal models. Whether the same pathways operate the same way in humans has not been established. Authors therefore tend to describe mechanisms as hypothetical rather than settled.
Direct human evidence is scarce. One trial in ulcerative colitis delivered the compound by enema and produced limited publicly reported results without a clear benefit. The compound is not an approved medicine in most jurisdictions. In many markets it is sold as a research chemical; in others it falls under prescription or controlled categories. Regulators have not confirmed any claimed medical use, and product labels rarely undergo premarket review.
== Further reading == Author I'm Not the Only One (2004) Mr Galloway Goes to Washington (2005) Fidel Castro Handbook (2006), MQ Publications. ISBN 1-84072-688-1 Respect: Documents of the Crisis (2008) with Salma Yaqoob and Alan Thornett Open Season: The Neil Lennon Story (2011) Miranda Media
== Education == McAlpine was awarded an honours bachelor's degree at Western University where she won a gold medal in zoology. She received a master's degree from the University of Toronto in 1966. Her thesis was called An assessment of the creatine kinase test in the detection of carriers of Duchenne muscular dystrophy. She went on to complete a PhD at University College London in 1970 with a thesis entitled Studies on the genetic variation of phosphoglucomutase in man. McAlpine was mentored and supervised by women in her field throughout her education. Her undergraduate work was performed under Helen Battle, and Margaret Thompson was her advisor in Toronto. Her PhD supervisor was Harry Harris.
=== International === Foreign governments said little in the days after the vote, most of them waiting for parliament to choose a prime minister. Once Anutin was returned to office on 19 March, United States Secretary of State Marco Rubio congratulated him and said the United States valued an alliance and friendship with Thailand spanning nearly two centuries, singling out law enforcement cooperation against cyber-scam networks and the modernisation of the defence relationship. Malaysian Prime Minister Anwar Ibrahim described Anutin as a "dear friend" and wrote that the two countries' "fates are like two rivers born of the same spring", pointing to trade, investment and cooperation along the border. Indian Prime Minister Narendra Modi followed the next day, saying that he looked forward to deepening the India-Thailand strategic partnership.
Sources: en.wikipedia.org
=== Amygdala neurons === This theory hypothesizes that an early developmental failure involving the amygdala cascades on the development of cortical areas that mediate social perception in the visual domain. The fusiform face area of the ventral stream is implicated. The idea is that it is involved in social knowledge and social cognition, and that the deficits in this network are instrumental in causing autism.
=== 21st century === In 2007, the 500th store opened in Seattle, Washington, and in 2010, the 1,000th opened in Beaverton, Oregon. As of March 2017, Jimmy John's had almost 3,000 stores with plans for expansion up to 5,000 and beyond. Liautaud realized that, in order to grow, he would need help acquiring better locations for his stores. Since he had little expertise in real estate, he decided to take on a partner who did. In January 2007, Liautaud sold a 33% stake to Weston Presidio, a San Francisco–based private-equity firm. In the first year after partnering with Weston Presidio, 100 real estate deals were closed. The company has completed two recapitalizations since Weston Presidio's investment. In the summer of 2015, pictures of Liautaud posing with big game circulated on social media, leading to increased calls to boycott his restaurants. In a 2015 interview with the Chicago Tribune, Liautaud said, "I don't hunt big African game anymore." In September 2016, Jimmy John's announced that Roark Capital Group had agreed to acquire a majority stake in the company. Terms of the transaction were not immediately disclosed, though it was later clarified that Liautaud retained 35% ownership of the company as part of the deal. As part of the agreement, Liautaud would continue as chairman of the board. On September 25, 2019, Inspire Brands (affiliated with Roark Capital Group) announced that it was buying Jimmy John's for an unspecified amount in a deal unanimously approved by Liautaud and the rest of the Jimmy John's board of directors.
Petroleum in some form has been used since ancient times. More than 4,300 years ago, bitumen was mentioned when the Sumerians used it to make boats. A tablet of the legend of the birth of Sargon of Akkad mentions a basket which was closed by straw and bitumen. More than 4,000 years ago, according to Herodotus and Diodorus Siculus, asphalt (bitumen) was used in the construction of the walls and towers of Babylon; there were oil pits near Ardericca and Babylon and a pitch spring on Zakynthos. In Babylon, petroleum was used for road construction, ship caulking, and medicine. The use of petroleum in ancient China dates back more than 2,000 years. The I Ching, one of the earliest Chinese writings, cites that oil in its raw state, without refining, was first discovered, extracted, and used in China in the 1st century BCE. In addition, the Chinese were the first to record the use of petroleum as fuel as early as the 4th century BCE. By 347 CE, oil was produced from bamboo-drilled wells in China. In the 7th century, petroleum was among the essential ingredients for Greek fire, an incendiary projectile weapon that was used by Byzantine Greeks against Arab ships attacking Constantinople. Crude oil was distilled by Persian chemists, with clear descriptions given in Arabic handbooks such as those of Abu Bakr al-Razi. In the 9th century, oil fields were exploited in the area around modern Baku, Azerbaijan. These fields were described by Abu Bakr al-Razi in the 10th century and by Marco Polo in the 13th century, who describes the output of those wells as hundreds of shiploads.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
It is not approved for human use in the United States or the European Union. Clinical material has been studied in a small number of early trials, mainly for inflammatory bowel conditions, and the compound remains investigational. Regulators treat marketed products as unapproved rather than as authorized drugs.
The peptide was named after a protein fraction found in human gastric juice, and the shorter form was called body protection compound. That phrase was shortened to the abbreviation BPC. The number 157 refers to a laboratory designation used in the original isolation work.
Its sequence corresponds to a segment of a protein present in gastric secretions, but the material supplied for research is made synthetically. No commercial product is purified from human or animal tissue. The synthetic route is used because it gives a defined chain length and a reproducible sequence.
Reversed-phase liquid chromatography with ultraviolet detection gives a purity estimate, while mass spectrometry confirms molecular mass and flags modifications. Amino acid analysis can add compositional confirmation. Results are most meaningful when a validated reference standard is run alongside the sample.